• What is MET?
  • MET in Lung Cancer
  • MET Exon 14 Skipping Mutations
  • Clinical Trials

MET

The MET gene (MNNG-HOS transforming geneCooper et al. 1984) located on chromosome 7, encodes a receptor tyrosine kinase (RTK) belonging to the MET/RON family of RTKs. Binding of its ligand, hepatocyte growth factor (HGF; also called scatter factor (SF)), induces a conformational change in the MET receptor that facilitates receptor phosphorylation and activation. Activated MET then phosphorylates its substrates, resulting in activation of multiple downstream pathways within the cell, including the PI3K-AKT-mTOR pathway, which is involved in cell survival, and the RAS-RAF-MEK-ERK pathway, which is involved in cell proliferation (Figure 1). In the context of malignancy, aberrant signaling through the MET receptor promotes pleiotrophic effects including growth, survival, invasion, migration, angiogenesis and metastasis (Birchmeier et al. 2003; Peruzzi and Bottaro 2006).

The MET receptor and/or its ligand HGF have been reported to be aberrantly activated in many human cancers (see http://www.vai.org/met/). Germline mutations in the tyrosine kinase domain of MET occur in 100% of hereditary papillary renal cell carcinoma, and somatic mutations in MET are found in 10–15% of sporadic papillary renal cell carcinoma (Schmidt et al. 1997). Mutations in MET have been reported at low frequencies in head and neck squamous cell carcinoma (Di Renzo et al. 2000), childhood hepatocellular carcinoma (Park et al. 1999), NSCLC (Kong-Beltran et al. 2006; Ma et al. 2003) and small cell lung cancer (Ma et al. 2003). Amplification of MET has been reported in gastric cancer (Nakajima et al. 1999), esophageal cancer (Miller et al. 2006), colorectal cancer (Umeki, Shiota, and Kawasaki 1999), gliomas (Beroukhim et al. 2007), clear cell ovarian cancer (Yamamoto et al. 2011) and NSCLC (Bean et al. 2007; Cappuzzo et al. 2009; Chen et al. 2009; Engelman et al. 2007; Kubo et al. 2009; Okuda et al. 2008; Onozato et al. 2009).


met.png

Figure 1.
Schematic of the MET signaling pathway. Growth factor binding to MET results in activation of the MAPK signaling pathway (RAS-RAF-MEK-ERK) and the PI3K pathway (PI3K-AKT-mTOR). The letter "K" within the schema denotes the tyrosine kinase domain.

Related Pathways

Contributors: Ben Solomon, M.D.

Suggested Citation: Solomon, B. 2015. MET. My Cancer Genome https://www.padiracinnovation.org/content/disease/lung-cancer/met/?tab=0 (Updated December 7).

Last Updated: December 7, 2015

MET in Non-Small Cell Lung Cancer (NSCLC)

In non-small cell lung cancer (NSCLC), multiple mechanisms of MET activation have been reported, including gene amplification (Bean et al. 2007; Cappuzzo et al. 2009; Chen et al. 2009; Engelman et al. 2007; Kubo et al. 2009; Okuda et al. 2008; Onozato et al. 2009) and mutation (Kong-Beltran et al. 2006; Ma et al. 2003).

Nonsynonymous MET mutations occurring in the juxtamembrane and semaphorin domains have been described in NSCLC and SCLC (Kong-Beltran et al. 2006; Ma et al. 2003; Ma et al. 2005a). However, some of these were recently identified in corresponding germline DNA (Krishnaswamy et al. 2009). The activity of MET inhibitors in NSCLC or SCLC tumors with non-kinase domain MET mutations is not yet known. By contrast, responses to foretanib (XL880 or GSK136308), an oral inhibitor of MET and other tyrosine kinases including VEGFR2, have been described in patients with papillary renal cell cancer (Eder et al. 2007). 100% of hereditary papillary renal cell carcinomas harbor germline activating mutations in the tyrosine kinase domain of MET (Schmidt et al. 1997).

MET protein expression may also be abnormal in tumors. Overexpression of MET protein in tumor tissue relative to adjacent normal tissues occurs in 25–75% of NSCLC and is associated with poor prognosis (Benedettini et al. 2010; Ichimura et al. 1996; Liu and Tsao 1993; Ma et al. 2005b; Nakamura et al. 2007; Olivero et al. 1996; Siegfried et al. 1998; Xu et al. 2010). In a recent phase II study in which patients with NSCLC were randomized to MetMab (an anti-MET antibody) plus erlotinib vs erlotinib alone, increased expression of MET protein was associated with improved progression free survival and overall survival in patients who received MetMAb and erlotinib (Spigel et al. 2011). Increased MET expression was defined as more than 50% of the tumor having moderate or high MET expression assessed by immunohistochemistry using a specific anti-MET antibody (Ventana CONFIRM anti-CMET clone SP44).

Contributors: Ben Solomon, M.D.

Suggested Citation: Solomon, B. 2014. MET in Non-Small Cell Lung Cancer (NSCLC). My Cancer Genome https://www.padiracinnovation.org/content/disease/lung-cancer/met/ (Updated August 8).

Last Updated: August 8, 2014

MET Exon 14 Skipping Mutations in Lung Cancer

Properties
Location of mutation Juxtamembrane domain (affecting exon 14)
Frequency of MET exon 14 skipping in lung adenocarcinoma 3–4% (Frampton et al. 2015; Onozato et al. 2009; Seo et al. 2012; TGCA 2014)
Implications for Targeted Therapeutics
Response to MET inhibitors Confers increased sensitivitya

MET alterations that result in exon 14 skipping are found in lung cancer in both the presence and absence of MET amplification (Awad et al. 2016; Frampton et al. 2015; Jenkins et al. 2015; Kollmannsberger et al. 2015; Liu et al. 2015; Onozato et al. 2009; Paik et al. 2015; Seo et al. 2012; TGCA 2014). Over 100 mutations in MET-mutated cancers resulting in exon 14 skipping have been described (Frampton et al. 2015). Exon 14 skipping results in the deletion of the juxtamembrane domain of MET, which leads to enhanced signaling through the MET receptor pathway (Kong-Beltran et al. 2006). This alteration is tumorigenic in xenograft models (Kong-Beltran et al. 2006).

a Both preclinical and case report evidence suggest that tumors harboring MET with exon 14 alterations and/or MET amplifications have increased sensitivity to MET inhibitors.

Reference Study Type Diagnosis Reported Alterations Line of Metastatic Therapy Therapy Best Response Duration of Response
Jenkins et al. 2015 Case report Lung adenocarcinoma

MET c.2887-18_2887-7del12 exon 14 splicing variant

CDKN2A/B-loss

CDK4 amplification

MDM2 amplification

Second Crizotinib Partial reponse 13 weeks (progression occured after therapy discontinuation
Paik et al. 2015    Case reports    Lung adenocarcinoma (poorly differentiated)

MET c. 3028G>C exon 14 splicing variant

MET amplification

RB1 intragenic deletion

DICER1 Q1776*

EPHA5 R853Q

KLF4 M1I

MLL I1929M

MTOR D537N

TERT G225E

FUBP1 amplification

GSK3B amplification

SDHA amplification

TERT amplification

KDM5A amplification

RAD52 amplification

MDM2 amplification

BCL2L1 amplification

NKX3-1 deletion

ETV6 deletion

Third Cabozantinib Stable disease 5.1 months (ongoing)
Lung adenocarcinoma

MET c.3024_3028+7delAGAAGGTATATT exon 14 splicing variant

TP53 exon 8 splice variant

FAT1 R782fs

FBXW7 G539V

MLL E1678K

NF1 E572fs

NTKR2 I191T

YES1 amplification

Third Crizotinib Partial reponse  3.6 months
Lung adenocarcinoma

MET c.3001_3021delGTAGACTACCGAGCTACTTTT

MET amplification

TP53 R248P

RB1 intragenic deletion

BRCA1 E648Q

MYC E137D

NF1 exon 56 splice variant

NDS1 E1902K

PDGFRB R397W

TERT gain

MYC amplification

NKX2-1 amplification

Third Crizotinib Partial reponse  4.6 months (ongoing)
Lung adenocarcinoma

MET c.3028G>T exon 14 splicing variant

CDK4 amplification

MDM2 amplification

 Third Crizotinib Partial reponse  3.1 months (ongoing)
Liu et al. 2015 Case report Pulmonary sarcomatoid carcinoma

MET c.2888delA exon 14 splicing variant

MET amplification

Third  Crizotinib Partial reponse NR
Lee et al. 2015 Case report Sarcomatoid non-small cell lung carcinoma

MET c.2888-5_2890TTAAGATC>A exon 14 splicing variant

MET c.3028+2T>G

Second  Crizotinib Partial reponse 5 months
Frampton et al. 2015 Case reports Large cell lung carcinoma

MET c.3028G>C exon 14 splicing variant

MET amplification

TP53 p.N30fs

First Capmatinib Partial reponse  5 months
Lung squamous cell carcinoma

MET c.3028+1G>T exon 14 splicing variant

MET amplification

Third Capmatinib Partial reponse 13 months
Kollmannsberger et al. 2015 Case reports Lung adenocarcinoma

MET c.2888-6_29del exon 14 splicing variant

 

Third MGCD265 Partial reponse 5 cycles (ongoing)
Lung adenocarcinoma MET c.3028+1G>T exon 14 splicing variant First MGCD265 Partial reponse 6 cycles (ongoing)
Schrock et al. 2016 Case reports Lung adenocarcinoma

MET c.3028+1_3028+1delG exon 14 splicing variant

MET amplification

CDK4 amplification

NR Crizotinib Partial reponse  24 months
Lung adenocarcinoma

MET D1010Y

NR Crizotinib Partial reponse 7 months (ongoing)
Lung adenocarcinoma

MET c.3028+1delG exon 14 splicing variant

MET amplification

MDM2 amplification

NR Crizotinib Complete reponse 7 months (ongoing)
Lung adenocarcinoma

MET D1010H

NR Crizotinib Stable Disease 4 months (ongoing)
Lung adenocarcinoma

MET c.2888-16_2888-3del14 exon 14 splicing variant

MET amplification

MDM2 amplification

NR Crizotinib Partial reponse 10 months (ongoing)
Lung squamous cell carcinoma

MET c.2888-11_2904del28 exon 14 splicing variant

NR Crizotinib Partial reponse NR
Lung adenocarcinoma

MET c.2888-16_2888-13delTTCT exon 14 splicing variant

NR Crizotinib Complete reponse 3 months (ongoing)
Lung adenocarcinoma

MET c.3028+1G>A exon 14 splicing variant

NR Crizotinib Complete reponse Unresectable to resectable and NED after resection
Awad et al. 2016 Case report Lung adenocarcinoma (poorly differentiated)

MET c.3028G>A exon 14 splicing variant

MET amplification

Second Crizotinib Partial reponse 8 months  (ongoing)

Notes: NR = Not reported; NED = No evidence of disease

Contributors: Christine M. Lovly, M.D., Ph.D., Paul K. Paik, M.D.

Suggested Citation: Lovly, C., P. Paik. 2017. MET Exon 14 Skipping Mutations in Lung Cancer. My Cancer Genome https://www.padiracinnovation.org/content/disease/lung-cancer/met/343/ (Updated June 15).

Last Updated: June 15, 2017

My Cancer Genome has released its new and improved cancer clinical trials search tool on our beta website. Please visit beta.padiracinnovation.org to check it out!

Disclaimer: The information presented at padiracinnovation.org is compiled from sources believed to be reliable. Extensive efforts have been made to make this information as accurate and as up-to-date as possible. However, the accuracy and completeness of this information cannot be guaranteed. Despite our best efforts, this information may contain typographical errors and omissions. The contents are to be used only as a guide, and health care providers should employ sound clinical judgment in interpreting this information for individual patient care.